Journal article

COMPARISON OF PNEUMOCYSTIS-CARINII DETECTION BY TOLUIDINE BLUE-O STAINING, DIRECT IMMUNOFLUORESCENCE AND DNA AMPLIFICATION IN SPUTUM SPECIMENS FROM HIV-POSITIVE PATIENTS

D EISEN, BC ROSS, J FAIRBAIRN, RJ WARREN, RW BAIRD, B DWYER

Pathology | ROYAL COLLEGE PATHOLOGISTS AUSTRALIA | Published : 1994

Abstract

Pneumocystis carinii pneumonia (PCP) is the commonest opportunistic infection in AIDS patients. By using the polymerase chain reaction (PCR), specific DNA sequences can be amplified and used in diagnosis of infections such as PCP where the causative pathogen is both difficult to grow and present in low numbers. Twenty HIV positive patients were investigated for PCP. Twenty sputa (15 induced and 5 expectorated) had toluidine blue O staining, direct immunofluorescence and PCR performed for Pneumocystis carinii in a blinded fashion. PCR was performed using primers pAZ102-E 5' GATGGCTGTTTCCAAGCCCA 3' and pAZ102-H 5' GTGTACGTTGCAAAGTACTC 3' from the gene coding for Pneumocystis carinii mitochondr..

View full abstract